Please describe any potential bugs you might have found

make sure you list:
1. a clear description of the problem, including what happens and what you think should happen (if it's not a crash or something that obviously shouldn't be happening)
2.the simplest set of actions that reproduces the problem
3. the version of ApE you are using
4. your operating system

Hi,

I'm working in Windows, with ApE version 2.0.47. When I save a graphical map as an .svg file, attempting to open that file in Firefox gives me a page with the following:
XML Parsing Error: syntax error
Location: file:///C:/Users/[my file path]/svgtest.svg
Line Number 1, Column 1:
svg  <width="514px" height="298px" xmlns="http://www.w3.org/2000/svg" version="1.1" preserveAspectRatio="xMidYMid meet" viewBox="-277 -179 514 298">
^
Likewise, Inkscape is unable to open the svg file (though no specific information is given, beyond "failed to load requested file"). Is there any workaround to this problem?

Cheers

Ooops, sorry,
I'll fix that in the next release, but the workaround is simple.
If you edit the svg in a text editor, move the < sign from after the svg to before it.
the first line will look like:
svg <width="513px"....
change it to look like:
<svg width="513px"


Excellent, thank you! The workaround works perfectly.

ApE (Mavericks)

Just downloaded ApE (Mavericks). When I try to open this software, got the message: Ape (Mavericks) is damaged and can't be opened. You should move it to the trash.

Why?
First of all, please add your questions to the page instead of deleting the header text- it'll help the next users of the page.
Second of all, how did you get to this page without reading somewhere along the way the answer to your question? Look back at the main page where you downloaded ApE. Search on the page for "Gatekeeper". Thanks.


Problem with sequence alignments

I'm having a problem with both pairwise (Align Two Sequences...) and multiple sequence (Align Sequences) alignments in 2.046 on Windows 7. When I align one or more .ab1 files to a reference sequence made in ApE, the sequences do not align with the homologous region in the reference file, even if they are trimmed so the sequences are identical. These are fairly long reads of ~500-700 bp. Instead, the ab1 files are aligned with the end of the reference sequence where there is no homology.

This problem does not occur with ApE 2.045. If it helps, I can send files where the problem happens all the time.
That would help, please email the files- thanks.


Problem with showing a circular map with restriction sites

I selected restrictions sites that cut my sequence exactly 4 times and pushed the "Graphic Map" button, and received the following error message:

can't use non-numeric string as operand of "+" can't use non-numeric string as operand of "+" while executing "expr {$radius + $radius_offset}" (procedure "draw_circular_feature" line 59) invoked from within
"draw_circular_feature $w $c $tag" (procedure "enz_graphic_map" line 124) invoked from within "enz_graphic_map .dna_window1" invoked from within "if {[.dna_window1.toolbar.graphic_map cget -relief] == "solid"} {.dna_window1.toolbar.graphic_map configure -bg gray78 -relief solid; enz_graphic_map ..." (command bound to event)

After clicking ok, I see an empty window with no map. This occurred first from the restriction enzymes dialog, but now it occurs every time I try to display a map of this particular plasmid.

Using ApE 2.0.45 running on Mac OS X 10.8.4.

This error looks like it's being caused by a corrupted feature. If you make a copy of the file and delete features until the error goes away, it should solve the problem. You can then just delete and make a new copy of the feature in the original file. Now, how did the feature get corrupted? Can you send me a copy of the file, so I can see what's the issue?



Problem with link between ORF window and the sequence window

Clicking on an amino acid in an ORF window should jump to the corresponding codon in the underlying sequence window. Instead it jumps to a single base two bases prior to the first base of the codon. Slect some text, Translate it, click on any amino acid to see this problem.
This worked OK in 2.0.33 and before, is wrong in 2.0.36 and after.
Either MacOS or Windows

(Hope I have done the edits right this time !)


Problem when using windows NTFS junctions
Before using ApE, I moved my whole user folder to another partition​ using the procedure outlined here:
http://lifehacker.com/5467758/move-the-users-directory-in-windows-7
Basically, I moved the folder C:\Users\myusername to D:\ and created a "junction point" (similar to a linux symlink) from the old location to the new one, so programs requesting access to C:\Users\myusername\somepath\somefile would actually, without knowing it, access D:\somepath\somefile.

Apparently ApE doesn't like this, because when I start it, an error message appears saying
"Can't create default user preferences. Error copying "pathToApE/Accessory Files/ApE_Defaults.txt" to "C:/Users/myUserName/AppData/Roaming/ApE/ApE_Defaults.txt": no such file or directory.".
The only option here is an OK button. After pressing it, it makes me choose another folder for storing defaults, and if I choose a location that is not junctioned, then it works normally.

Next time I start the program, it shows the first error message again, and makes me choose another folder again; and if I choose the same location from before, It gives the following error message:
"Can't create default user preferences. Error copying "pathToApE/Accessory Files/ApE_Defaults.txt" to "Path/ApE_Defaults.txt": file already exists.".

Version of ApE used: v2.0.45
Version of Windows used: Windows 7 Home Premium

Bug in RE Digestion applied to a selection
1. If I select par or all of a sequence, and then do an in silico digest, the 'gel' picture should show only the bands arising from digestion. This is what I see in 2.0.40. In 2.0.45, the whole selection appears as a band as well (and I have checked, and 'Partial digestion' is set to 100%!)

2.Open a file. Select the whole of or a part of the sequence. Open the Enzymes dialog, select at least one enzyme that cuts at least once in the sequence. Select the box marked 'Selection'. Click the digest button. Look at the bands in the 'gel'
Note, this bug works even if you select the whole sequence. It seems to be a function of whther the 'Selection' box is checked, or the corresponding menu item checked.
3. 2.0.45 (also tested 2.0.40, which works as it should)

4. Windows XP

Thanks. I'll look into this.

Misalignment of sequences with indels (sometimes)

1. When aligning two sequences in "classic" mode (e.g., shift-click on the alignment button to align a sequencing read with the target sequence), sometimes the sequences will appear to be aligned (no red highlighting of gaps or mismatches, vertical bars connecting every residue in the top sequence with the bottom one) BUT the sequences will be out of register by 1 bp. In example below, the sequences are properly aligned for the first ~20bp, then shift relative to one another (e.g., check the alignment of the start codon highlighted in green):

Screen Shot 2012-08-31 at 11.52.35 AM.png

This bug is fairly problematic, as it can mask a true single bp deletion (in the test files, the misalignment begins at the site of a deletion).

On a perhaps related note, sometimes features seem to be "mis-mapped" onto the alignment. For example, if a feature is defined as bp 101-200 and is highlighted correctly in the main ApE window, sometimes 99-198 will be highlighted in the alignment window.

Both of these bugs are fairly rare, but occur frequently enough that I have encountered them both several times (maybe 1:250 alignments?).

2. The misalignment bug can be reproduced using the files provided here:



Unfortunately, I can't remember a set of files that can reproduce the mis-highlighting bug.

3. version 2.0.44

4. OSX 10.7.4

Using the same files, the bug DOES NOT occur in version 1.17 on a machine running Windows.

Thanks- as you said, it'll be a rare instance when this bug crops up. I've figured it out and It's fixed. It'll be in the next release 2.0.46. Some workarounds until the release: If you use the multi-align, it'll be obvious that the alignment is faulty by many red mismatched bases. If you change the length of the reference sequence (the 1st sequence) so that it is 1 base longer or shorter before the indel the alignment will work. The alignment routines are completely new, and for the most part better I hope, in 2.0.x vs 1.17.


Favorites Window not displayed, Program hangs
1+2. The program crashes / no longer reacts to commands, if I try to use the button Favorites -> Edit favorites in the New feature window. Nothing happens upon clicking the button. But if I click it again, I get the following error message:

window name "edit_color_favorites" already exists in parent
window name "edit_color_favorites" already exists in parent
while executing "toplevel .edit_color_favorites"
(procedure "edit_color_favorites" line 12)
invoked from within "edit_color_favorites .edit_feature_dialog2.infoframe.colorframe.favs.menu" (menu invoke)

I assume, that the window pops up invisibly or somewhere in the background, where I cannot access it (neither does it show in the task manager). After trying to call that Edit favorites function, ApE no longer reacts (seems to be waiting for closing of that invisible window) and has to be killed using the task manager.

3. ApE 2.0.44
4. Windows Vista Business 64 bit

Otherwise ApE is a really great tool. Thanks for creating it!
Thanks- I'll try to get a fix in the next release.


Overlapping feature names in graphic of Linear DNA

ApE version 2.0.44 in MacOs 10.7.4
When you graph a linear piece of DNA with closely spaced features using the either the enzyme selector/graphic+U, or directly with graphic map functions, the feature names overlap and can't be read. Same file in 2.0.29 alpha shows nicely stacked names running down the page. My apologies, this post is listed in comments as well but lacks system info.
Also answered in comments- The texts and features can be moved with Ctrl/Command drag. If you drag the feature, the text moves with it. If you move the text, the feature doesn't move.


Problem with starting Wish

2012.03.31
Using ApE 2.0.36 on Mac (Lion, 10.7.3)
I had an issue where ApE would not start at all. I tried it from the command line, and I got the error: "Application initialization failed: unknown color name "S_base03"
It turned out to be the ".Xdefaults" file in my home directory, which contained a non-standard color specification.
I guess the script is reading this file, even if it's not to be used. Probably this is not a common issue, but just in case it matters I've documented it here.


Problem with changing colors of features

Using ApE 2.0.41 on Mac (Snow Leopard)
I noticed in the last couple months that all the features of the same type in my sequence files were turning the same color, even after I had individually changed them to something different. In previous editions I was able to set different colors for adjacent features of the same type so that I could easily distinguish them, save it, close the file, and then later open it and the colors would be the same.

To test the behaviour I removed the most recent version of ApE from my computer and went backwards, loading each previous version. Strangely, they all seem to be converting the features of the same type (example: CDS or gene) into the same color upon closing the file and re-opening it. Since they didn't used to have this behaviour, this suggests to me that it is an issue with a change to Snow Leopard and not ApE.

One additional thing I noticed was that files I had made >6 months ago can be opened and viewed and the colors of their features don't change. I haven't tried modifying the files though.


I don't think it's a problem with Snow Leopard. I think you have set "Strict Genbank Format" in your Preferences (in the Files section). This setting will prevent saving of feature colors (and other ApE specific information). This is why all your ApE versions are doing the same thing- it's in your preferences file, which all versions are using. This is also why old files still work but new ones don't. Just turn off Strict Genbank and you should be fine. That setting is only for people who wnat to export to other programs that can't ignore the ApE information imbedded in the format.

Update: Tried this and it worked. Thank you very much! That was really bugging me. Maybe adding a popup to the program that warns you of this possibility whenever you want to select this?

Problem with Nucleotide pattern search
I am trying to perform a nucleotide pattern search:
CAnPYnnAnnCYYGTTnnnPnYnnYACAn (SceI cutting site, see
http://www.jbc.org/content/259/16/10499.abstract)
on the Acinetobacter ADPI genome (http://www.ncbi.nlm.nih.gov/nuccore/NC_005966.1), using ApE vers 2.0.37 on a wintage win2K-pro system.
(options circular dna and no dam/dcm).

The search gives the following hits with ApE "find" function:
CACCGTACACTTGTTGTTGCGACACAT near 1487776
which actually does *not* match the requested pattern (both pasted below in the font 'courrier new' with equal spacing)
CANPYNNANNCYYGTTNNNPNYNNYACA
-CACCGTACACTTGTTGTTGCGACACAT

ApE uses the IUPAC standard DNA degeneracy codes (see http://www.dna.affrc.go.jp/misc/MPsrch/InfoIUPAC.html) and ignores all characters that are not part of that code set.
I have never seen P used for purine bases in any standard.
So ApE is ignoring the "P" in your search, and is searching for
CANYNNANNCYYGTTNNNNYNNYACAN which matches

CACCGTACACTTGTTGTTGCGACACAT

If you use the IUPAC code R for purine your search should work.


Problems with "Find" function in ApE 2.0.20 alpha (XP 32-bit) (1/4/2011)

When searching in a short sequence (200bp), the "Find Next" button does not find anything, regardless of whether the sequence searched for exists or not - I can even search for single bases and it fails. However, the "Find Prev" button finds the sequence as expected. If I highlight the whole sequence before performing the "Find Next" search, it sometimes succeeds and sometimes fails to find the search string.

are you sure you have the cursor BEFORE the sequence you are trying to find? Find next doesn't wrap on linear sequences. If your cursor is after the sequence, find previous will work, but find next won't. Also, If you select all by dragging from the end to the beginning, find next will work, because the sursor is at the beginning. However, if you select from start to end, the cursor will be at the end and so find next won't work. If this doesn't solve the issue, let me know. Thanks.

Update: This was indeed the problem. I am used to working with circular sequences and didn't realize that find didn't wrap when linear. Do you think that not wrapping "find" is useful? Maybe add a "search from the beginning" button to the "No Sequence Found" message for linear sequences, like word processors often do.


Potential Bug/Crash Report 2010/11/19
I wrote the same crash report below.
I downgraded to ApE 1.16 from 2.0.29 though, it does still not work at all.
Could you please help???

can you email me at wdavis@biology.utah.edu and we can try to get this worked out- I'll need a lot more detail than what you have here.






In the linux ApE 2.0.29 script, on line 16354, there's a missing '$' for bgcolor:
'$s.$list_box itemconfigure end -background bgcolor'

(The error that this triggers leads to an incomplete DNA alignment window)


  • thanks.
  • It's fixed in 2.0.30







Bug report 2010/07/16: Fail to identify all restriction cutting sites:

Depending on the actual sequence between the two identical cutting sites (XbaI TCTAGA in this example), the total number of the identified restriction sites varies.

TCTAGAtcgagcatgcaTCTAGA gives XbaI(1)

TCTAGAaTCTAGA gives XbaI(2)

Using ApE 2.0.29, Windows XP


  • Turn off Dam/Dcm for the sequence. XbaI is blocked by overlapping Dam methylation- the first site in the first example has a GAtc Dam site.



Bug 1: Mistranslation in three-letter mode:

1. If you translate with one letter amino acid code, the CAG codon is correctly translated as Q, glutamine. In three letter mode, it is mislabeled Glu (Glutamic Acid) instead of Gln (glutamine).

Using the following sequence: GAT GAT GAA AGT GGA GCG TGT GGT CAG GAG AAT TTC GAT CCC CAT GAT GCC GAT
and the following options: Code 3-letter, Codon spacing ON, Reverse complement OFF, Line width 40, Line numbers LEFT, DNA ABOVE, Copy highlight OFF.

Using ApE 2.0.15, Mac OS X 10.5.8


  • Thanks, I fixed it in 2.0.27.




No margins in text files

1. Text file windows, such as are produced by Translation or Absent Sites, do not print completely. The top and left hand sides do not print because there are no margins. I haven't found a work-around using Page Set-up or printer options. Sometimes it's nice to have a hard copy of these files.
2. Open any sequence file, go to Menu->Enzymes->Quicklists->Absent Sites. This produces a file in a new window. Print it.
3. ApE v2.0.25
4. Mac OS X 10.5.8

  • Possibly fixed in 2.0.28.




1. When I open new window in Ape2 this happens: http://yfrog.com/4japep (Ape2-left, Ape1 right). Sequence is aligned up to 40 bases. This returns back to normal after resizing the window by dragging the lower-right corner. Also, background of the window is brighter than the background of buttons -> looks ugly.

This maybe belongs to features but I personally don't like the new icons. I find them less intuitive then the old ones, especially Select from-to, reverse complement (looks like reload button), highlight selected enzymes, find primers (that reminds me fast forward button). I suggest maybe redrawing the old ones in hires.
2. Open sequence or blank window in any Ape 2 version
3. Ape 2.0.25
4. PowerPC G5 with Mac OS X 10.4.11

  • The text width alignment bug (window forcing the text box to be 80 characters wide when default text widths set to <80) has been a long-standing one in v2.x, but I think I've fixed it- check out v2.0.27
  • button background should be fixed there too.
  • I might improve the toolbar button images sometime. Overall, I think the new ones are better, but I agree about the ones you mention being the least better. I'll work on them sometime. Hires isn't the issue, it's artistic ability.

1. ApE fails to start, .Error in startup script.

2. Place ApE.exe in program files and start.
3. ApE 2.0.26
4. Windows 7 Ultimate 32 bit

  • fixed in v2.0.27




1. Plasmid map gives the following error when launched and when you double-click features in the map window no longer they are selected in the text. Still it seems to work fine otherwise.


  • invalid command name ".dna_window1_analysis0.menubar.outputmenu"
  • invalid command name ".dna_window1_analysis0.menubar.outputmenu"
  • while executing
  • "$a.menubar.outputmenu insert 0 command -label "Configure" -state normal -command "circular_map_configure_dialog $c \$c_withtag_current; unset c_withta..."
  • (procedure "enz_graphic_map" line 376)
  • invoked from within
  • "enz_graphic_map .dna_window1"
  • invoked from within
  • "if {[.dna_window1.toolbar.graphic_map cget -relief] == "solid"} {.dna_window1.toolbar.graphic_map configure -bg SystemMenu -relief solid; enz_graphic_..."
  • (command bound to event)
2. Launch any graphical map from the menu or the toolbar.

3. v2.0.27
4. Windows 7 Ultimate 32 bit

  • Fixed in 2.0.28

1. Preferences dialog when launched gives the following error and you cannot close down the preferences window after. I have to manually kill the ApE.exe.


  • bad window path name ".dialog.tabsframe.speech"
  • bad window path name ".dialog.tabsframe.speech"
  • while executing
  • "grid rowconfigure $t.speech 14 -weight 1"
  • (procedure "configure_preferences" line 293)
  • invoked from within
  • "configure_preferences .dna_window0"
  • (menu invoke)
2. Launch preferences

3. v2.0.27
4. Windows 7 Ultimate 32 bit

  • Fixed in 2.0.28- up on site soon

1. "Selection Translate" does not seem to work, I don't see the handy string of amino acids in its usual place.

2. Select "Selection Translate" and highlight any sequence.
3. v2.0.27
4. Windows 7 Ultimate 32 bit

  • Fixed in 2.0.28

1. Follow-up on the previous bug: Plasmid map gives the following error when launched and when you double-click features in the map window no longer they are selected in the text (feature selection works in linear plasmid maps!). Still it seems to work fine otherwise.


  • invalid command name ".dna_window1_analysis0.menubar.outputmenu"
  • invalid command name ".dna_window1_analysis0.menubar.outputmenu"
  • while executing
  • "$a.menubar.outputmenu index [mc "Scale"]"

  • (procedure "enz_graphic_map" line 387)

  • invoked from within**
  • "enz_graphic_map .dna_window1"
  • invoked from within
  • "if {[.dna_window1.toolbar.graphic_map cget -relief] == "solid"} {.dna_window1.toolbar.graphic_map configure -bg SystemMenu -relief solid; enz_graphic_..."
  • (command bound to event)
2. Launch any graphical map from the menu or the toolbar.
3. v2.0.28
4. Windows 7 Ultimate 32 bit
  • Sorry about that- I've uploaded a NEW v2.0.28 for PC (April 15) which should solve this.


1. Feature sequences are not selected in the text when you double click them on the graphical map for a circular sequence. Linear sequence selecting works.
Similarly, restriction digest site selection does not place the cursor in the cut site in the sequence.
2. Double-click a feature in the graphical map of a circular sequence.
3. v2.0.28
4. Windows 7 Ultimate 32 bit
  • I changed that to a ctrl-click in 2.0.25-2.0.28. I thought it would make more sense that way. Everyone HATES it. I changed it back in 2.0.29.

1. ApE starts and I can save sequence files but I cannot re-open them after saving. Nothing happens, no error. - I found out that the phenomenon is somehow connected to using network drives. If I save the sequence file to my hard disk, I can re-open it just normally.
2. Double-click a sequence file or start ApE, then choose Open File from the menu and select a sequence file.
3. v2.0.29 (or v2.0.27)
4. Windows 7 Professional
  • The open file dialog allows selecting a file, but then nothing happens? Or is there an error?


1. 2. When double-clicking on a sequence file to directly open it while ApE is not already started, the name of the sequence file is not re-transcribed correctly but with a short DOS-style name (e.g. pAB01~1.gb instead of pAB0123.gb). This problem does not occur if ApE is already running when double-clicking on the file.
3. v1.17 and v2.0.29c
4. Windows 2000
  • should be fixed in V2.0.29d- will upload soon.



1. Scrolling down with the mouse-wheel is not working, you can only scroll up.
2. Click anywhere in the sequence and use the mouse-wheel to scroll.
3. v2.0.30
4. Windows 7 Ultimate 32 bit
  • Possible solution: press ctrl-0 (zero), in the new console window, type or paste: set info(mousewheelunits) 4. email me if that does or doesn't solve the problem.




1. Open a sequence file and open an sequencing ab1 file.
2. Do an alignment between the sequence file and the ab1 file.
3. Double click a residue of the sequencing sequence in the alignment. The ab1 file window jumps to the front and one residue is highlighted.
4. The highlighted residue is not the residue I clicked, but the residue next to it.
5. Mac OS X 10.6.4 and version 2.0.30
  • Thanks. That's a known bug- I need to get around to fixing it though.

This bug still exists in version 2.0.31. It is confusing and annoying. Please crush this bug. May I make related feature request? In the ab1 file window, when I click a base on the upper part of the window, could it show a bar instead of a vertical line on the right side of the base? It would be much easier to match the base and the peak at the bottom.
  • Ok, V2.0.32 is up with the bug fixed. If you shift-click you can get the bar instead of the line. I might change that in the future.

Thanks. The bug is fixed and the new feature is working. Just a slight problem though, when I first shift-click a residue to get a bar and shift-click a second residue, I got the bar for the whole block between the first and second residues. That is not what I expected.
  • It works just like the cursor in the sequence window- single click to get a line cursor, then shift click to select the sequence from the cursor to the mouse position.

UPDATE: version 2.0.33.

1. The bar shows in the ab1 file doesn't correspond to the residue I clicked in the alignment window. But 2 residues next to it.
2. The bar position is correct in the forward sequence. But 2 residues off in the reverse sequence.
  • Thanks. I think I've fixed it in 2.0.35 out soon.

Nice. When will 2.0.35 come out?



  1. Trying to paste a sequence into a new window, it pops a window to ask me to save the file.

I don't want to save the sequence as a file. How do I turn this off? The previous version didn't ask me to save files each time I paste sequence into a new window.

Mac OS X 10.6.6 and version 2.0.32.

update: it only happens when the first line of the sequence is >#%$@.
  • That's right. When you just paste DNA sequence it pastes into the window that is open. If you paste what ApE thinks is the contents of an independent sequence file (in FASTA or Genbank format) it creates a new file with the contents of the clipboard. This is by design.



2011-04-26
Pasting a Genbank sequence from Wormbase to Ape (V. 2.0.33) does NOT work.

I've tried with two examples already and in both cases I get an "Eror: bad dna sequence in genbank" error.
After I click OK on the error box, the Ape sequence shown is: brmaryshashcd

Note: This used to work (a few months ago) but perhaps either Wormbase changed something or the code changed?

Mac OS X 10.6.7 and version 2.0.33
I followed the instructions from the main page: (Genbank Format, Text format, Sorted). I.e.:

Thanks.
  • If it's from Wormbase, it's probably bad genbank format (again). They don't have much concern for standards in file formats. If you send me an example file by email (or attach it here), I'll see if I can write another workaround.

2011-04-27
OK, that's what I figured. I emailed you a couple of examples. Thanks!




2011-09-15

1. With ApE already running but with no ApE windows open pressing CMD+N does not create a new window even though that's the assigned keyboard shortcut for it. With any ApE window already open CMD+N does open a new window.
2. Launch ApE, close the window, press CMD+N
3. 2.0.36
4. OS X 10.7.1 (but it happened in Snow Leopard too)
  • That's a tough one- I'm having trouble getting keystroke events into the window that's responsible when no windows are open. It's a Tcl/Tk issue, I think.


2012-02-14

I am trying to align my template sequence to an ab1 file. I found the following alignment a bit weird with unnecessary gaps introduced.

1301>TGTTTCAAGGGCCTGGGGCCGCAGAAGATCAAGTTGATCCAAGATTGATTGATGGCAAGCATCACCATCACCATCACCATCAC------TAG-------->1386
..185<TGTTTCAAGGGCCTGGGGCCGCAGAAGATCAAGTTGATCCAAGATTGATTGATGGCAAGCATCA------CCATCACCATCACCATCACTAGAATCAACC<92

How do I align them without gaps? Which brings another question. When I align template sequence with sequencing result files, gaps are not very common. However, APE likes to introduce some gaps instead of just treating them as mismatches. I understand this probably gives a better score. Is there a way to limit gaps?
  • Right- that's a bug. I've uploaded 2.0.41 which fixes that and another bug I found in the alignment when I was looking at this one. You can change the gap penalties by looking in the alignment parameters (a button at the bottom of the dialog opens the settings box). This gap was caused by the heuristic doing the block alignment. If you change the blocks setting to "N-W align all" it will take a lot longer but will apply the gaps penalty uniformly to the entire alignment.

Thanks. The new version fixed the bug. However, when I tried "N-W align all", I found out that it would not try to align the sequence using reverse complement automatically whereas block alignment tried both sequences and picked the best alignment.
  • I just fixed that too. I didn't change the version number, but uploaded a fixed version.

Well, I just tried it and it still didn't work for me. I had to select reverse complement to get "N-W align all" to work for a reverse sequencing.
  • You may have your N-W max parameter set too low. That parameter keeps the algorithm from trying to do a very long N-W align without your permission. If the product of the lengths of two sequences it is trying to align (either after the block alignment or a N-W align all) is greater than N-W max, it will skip the alignment. You can set this to a very large number so that it will always do N-W alignments, even for very long sequences that will take a long time.





2012-03-27

I'm currently having issues importing genbank files. When it is opened all the features are one color. Is this what commonly happens?
  • Genbank format does not actually contain any way to specify display formatting for features in the file. ApE adds on a non-standard-ish way of specifying the color etc. of a feature by adding special sub-features. So, if you import a genbank without ApE formatting commands, ApE uses your default formatting for the feature type of each feature- exon, cds, misc_feature etc. If you edit a feature of a particular type or create a new one of that type, you can specify that the formatting that you apply to that feature becomes the default for that type. Then, if you open a genbank file all features of that type will have that color formatting applied.




2013-04-24
Hello,
I am having trouble with Ape graphics and text rendering on Windows 8.1 Everything looks blurry. Also, Ape freezes and hangs the machine when I open >3-4 files at once, which never happened on Windows 7. I am running v 2.0.47. Thanks!