ApE Feature Request: (Jan 4, 2010)

Can something be done to isolate restriction enzymes with double-negative cut offsets? (e.g. BsiI, CACGAG -5/-1) I ask because they're in the 'degenerate cut' group right now, which is getting in my way (trying to find true degenerate cutters for a bunch of sequences I have).

The enzyme groups are fully editable- You can double click on an enzyme in the selection dialog to change the groups it is in. Alternatively you can make a new group that only includes the enzymes you are interested in. To do this, select all of the enzymes you want in the new group, then go to the menu item "Enzymes>New Group...". This will ask you to name the new group. You can then go to the Menu "File>Save Current as Default", and the groups will be saved.





ApE Feature Request: (November 26, 2010)

It would be useful to have the contents of the comments box printed on the same sheet of paper (or pdf) as the plasmid maps, to include information such as references, how the plasmid was made, diagnostic enzyme digests, etc. for distribution. Perhaps this could be done as an option in "page set-up" that allows printing of the contents of the comments box at the bottom of the plasmid maps. Alternatively, there could be some way of including the comments in the same window as the maps as they are generated so that they can be printed together.

I'm hoping to have that option available in a future version- there will be a major improvement in the graphic maps, both on screen and in print.
Hard to know right now when that will happen, though.





ApE Feature Request: (November 8, 2010)


Hi there,

the Tol2Kit provides several Gateway destination plasmids, which in some cases require Multisite-reactions of the Prototype 1-2-3. Since you have any other reaction type included in your great program, would it be possible to also add the 1-2-3? Or is there any sort of trick to perform this reaction? Thank you!

PS: If you could include "reverse BP" cloning (taking out fragments by BP cloning results only in the respective ENTR-clone containing the insert not in the Dest-vector with the ccdb-CmR-containing insert) it would be even better!

sure- you can edit the prototypes to add or delete any that you want. It's a bit tricky, but not too hard:
open your ApE_Defaults.txt file (it's in /your_name/Library/Preferences/ApE on the mac, for example)

anywhere there (maybe at the end), you can add the line
recomb,prototypes {BP Reaction (1-2)} Insert Backbone} {attL1 0 attL2 1 {Single-site LR Reaction (1-2)} Insert Backbone} {attB1 0 attB2 1 {BP Reaction (4-1)} Insert Backbone} {attL4 0 attR1 0 {BP Reaction (2-3)} Insert Backbone} {attR2 1 attL3 1 {Mutlti-site LR Reaction (4-1-2-3)} Promoter Gene UTR Backbone} {attB4 0 attB1 0 attB2 1 attB3 1 {BP Reaction (1-5)} Insert Backbone} {attL1 0 attR5 0 {BP Reaction (5-2)} Insert Backbone} {attL5 0 attL2 1 {Multi-site Pro LR Reaction (1-5-2)} "Fragment 1" "Fragment 2" Backbone} {attB1 0 attB5 0 attB2 1 {BP Reaction (1-4)} Insert Backbone} {attL1 0 attL4 1 {BP Reaction (4-3)} Insert Backbone} {attR4 1 attR3 0 {BP Reaction (3-2)} Insert Backbone} {attL3 0 attL2 1 {Multi-site Pro LR Reaction (1-4-3-2)} "Fragment 1" "Fragment 2" "Fragment 3" Backbone} {attB1 0 attB4 1 attB3 0 attB2 1 {BP Reaction (5-4)} Insert Backbone} {attL5 0 attL4 1 {Multi-site Pro LR Reaction (1-5-4-3-2)} "Fragment 1" "Fragment 2" "Fragment 3" "Fragment 4" Backbone} {attB1 0 attB5 0 attB4 1 attB3 0 attB2 1 {Multi-site LR Reaction (4-1-2)} Promoter Gene Backbone} {attB4 0 attB1 0 attB2 1 {BP Reaction (1-2-2-1)} Insert Intron Insert(rev) Backbone} {attL1 0 attL2 1 attL2 0 attL1 1 {Reverse BP Reaction (1-2)} Insert Backbone} {attR1 0 attR2 1 {Reverse BP Reaction (4-1)} Insert Backbone} {attR4 0 attL1 0 {LR Reaction (4-1)} Insert Backbone} {attB4 0 attB1 0 {Reverse BP Reaction (2-3)} Insert Backbone} {attL2 1 attR3 1 {Reverse BP Reaction (1-5)} Insert Backbone} {attR1 0 attL5 0 {Reverse BP Reaction (5-2)} Insert Backbone} {attR5 0 attR2 1 {Reverse BP Reaction (1-4)} Insert Backbone} {attR1 0 attR4 1 {Reverse BP Reaction (4-3)} Insert Backbone} {attL4 1 attL3 0 {Reverse BP Reaction (3-2)} Insert Backbone} {attR3 0 attR2 1 {Reverse BP Reaction (5-4)} Insert Backbone} {attR5 0 attR4 1

you can edit the list to add or remove reations.
the format for each reaction is: {name of prototype} name_of_fragment1 name_of_fragment2 ...name_of_fragmentN} {att_site1 att_site1_direction att_site2 att_site2_direction ... att_siteN att_siteN_direction
the list of fragment names and the list of att sites and directions is as occurs in the PRODUCT.
note that there is a single tab character just after recomb,prototypes, NOT spaces. Some copy/pastes will replace the tab with a space- change it back.

alteranatively, you can add to the default list by adding a similar line
recomb,prototypes,additional
followed by a tab and a list of prototypes.

IMPORTANT- only use recomb,prototypes,additional OR recomb,prototypes in your defaults file. If you use both it'll cause problems.
BE SURE YOU SAVE THE FILE AS PLAIN TEXT. RTF AND WORD ARE NOT PLAIN TEXT FILES.





ApE Feature Request: (September 23, 2010)



Multiple digests in the same digest window. Currently in version 2.0.30 the lanes are numbered at the top, but I can not find a way to do more than one digest at a time. It would be nice to say "Add to virtual gel" in the enzyme selection window, then change choose different enzymes, or different plasmids, and add these to the virtual gel. When all lanes have been added, clicking the "Digest" button (or a new button) would then bring up the virtual gel with all the digests in the same window. It may even be nice if it were possible to include and undigested option.

Even without this feature, ApE is an excellent little piece of software. Thanks for sharing it.

  • In 2.0.30 you can drag and drop one gel lane into another window. So, you can make multiple different digests, each in a separate window, then drag them all together into the same window. If you mouse over a band, the text on the left changes to show the info for that digest. To get a list of what each lane is, press the info button on the right. It is not clear what would be reasonable to show for undigested circular sequences.







Ape 2.0 Feature Request (May 18, 2010)
  1. Add option to "Download sequence from Wormbase". What I am looking for here is the ability to download, i.e. the unspliced version of a given gene (including features such exons, introns, UTRs, etc). Great program BTW! A joy to use.
If you are looking to get the data out of the genome browser: in the upper right corner, above the scroll zoom options, select the option "Download Sequence FIle", then click "Configure", then output:text, format:genbank, sorted locations:yes, press the go button. You can then copy all and paste it into an ApE window (in ApE 2.0.29).
  1. Also, a +1 on the request for "It would be nice if there was a way to see overlapping features." Thanks!
Working on it.
  1. Add a Shortcut key for "New Feature".
ok- any suggestions which key?
  1. Ok, one more. Allow "Esc" key to "close" a window (i.e. the "Find" window). I think "Esc" is the standard close box (at least in Mac GUIs). (or at least make a key option to close a window from keyboard).
ok. sequence and analysis windows close with apple-w. I'll set esc key to close dialogs.

Ape 2.0 Feature Request
  • BLAST sequences at Wormbase is missing. It was a very convenient feature, I am not sure why it was removed.

Wormbase changed their BLAST interface page. The webmaster told me at one time that he was going to make an API, but no luck with that yet. Contact them and let them know you are interested in the option of other programs integrating with their BLAST service.

  • The old implementation is still working for me, while not completely automatic (two clicks to change query type to "Nucleotide" and submit) still saves a lot of time. I'll contact wormbase people, too. Also, what about other databases for blast for other major model organisms? They can also be included as a quick menu link and replace wormbase option (changeable in preferences perhaps) to save time.

Yes, that would be good. I've thought about some way to have user specified files that would tell ApE a website and the form fields it needs to fill in, so that people could have a web tools folder that they put these files into and can send sequences to various web tools this way.



  • How about adding in silico cloning tool?
Yes, but what would that look like? There are digests, gel purifications, multi-fragment ligations, PCR (with 5' additions), Klenow, exonuclease, In-fusion. I've been thinking about it, but I'm not sure how to make a clean user interface that is still flexible enough to do everything a user would want to do. Just a simple two fragment cut and paste is faster with the standard cut and paste mechanism, no extra interface involved. Maybe I could find a way to make this work.


  • Having layers of sequence features would help to reduce the clutter of having many labelled features for a sequence of DNA. I often add primer sequences as features. I don't want to delete old features, but as more accumulate it becomes hard to make sense of them and it would be nice to be able to hide a group of similar features.
Yes, That is in my long to-do list. I have some code started in fact, but it might take a while, as it involves reworking a lot of the feature code.


  • An interface for quickly adding primer sequences, separate from the feature interface. A table format compatible with copy/paste would be great.
I could make an output (either a text window, or straight to the clipboard) of a table of specific feature types. If you make your primers of primer_bind type, that could work.


  • It would be nice if there was a way to see overlapping features. Perhaps an intermediate color or a background that is partially the color of one feature and partially the color of the overlapping one.
Finding intermediate colors is sometimes hard (depending on the two colors). There is no transparency feature for text backgrounds in Tk yt. This is a good suggestion, but hard to implement. I'll think about it.


  • I see there are lot of requests about sequence features. I'll add few more. I think it would be more clearly to show features which overlap in plasmid graphic map on different distance from the center of plasmid circle. I mean something which will look like this: http://www.addgene.org/pgvec1?f=c&plasmidid=11909&cmd=genmap&mtime=1213368411 And another feature which I think would be useful is adding another optional line in sequence translation window so the fist line would be amino acids, second nucleotide sequences and third features of the sequence.
Yes, I'm currently working on a circular map with a lot of changes to make it more attractive and usable. Check out v2.0.25- you can move texts around, and format the info text items. I'm planning to provide editing of the arrows and the positions of features soon.

Interesting idea on including features in the translation window. Have you tried the text map window- that might be what you are looking for- you can turn on features, translations and sequence there, and format them in many ways.
  • You're right that's almost what I've been looking for. Only thing that's missing is grouping nucleotide sequence in 3 corresponding to translated amino acid. But this might be hard to implement.
I will add it to the todo list.



Hi
  • Features:
  • I was wondering if you would think it would be useful to be able to create some personal features, such as "PCR", to show pcr fragments, or "digest", for digested fragments...
  • In the same line, I was wondering if there would be a possibility to have a "naming" tool for features so that when we create a feature, the name associated to it has specific informations: as an example, I have been trying to have a nomenclature for my features, so that we can share them in the lab, by exchanging the features text/excel file. So for exons, I call them "exX" where X is the number of the exon. Then I have an underscore, and the name of the gene (I work with C. elegans), "dat-1". So that I name the exon 1 of dat-1 feature, ex1_dat-1. The advantage of this kind of "nomenclature" is that it makes it very easy to share, and you can virtually have your sequences annotated using the feature library of someone else. On a larger scale, I think it would be so good to be able to have common libraries may be here, that we could edit and improve so that we could readily annotate new sequences. I don't know if that is very clear and understandable, so please tell me if more information is needed...
I don't understand what you are asking about a "naming" tool- you can give all features a name in the feature library, or rename them in each sequence. If you are thinking of the option of feature "groups", that is in the works for the new rewrite of the feature library tools. You will be able to assign multiple groups to each feature, with many features in each group. When you scan a sequence with a library, the name of the library file will be one of the default groups. You will be able to show/ hide groups of features- primers, CDS etc.
I agree that it is useful to have a consistent nomenclature for your features. I would hope that people adopt some consistency that is most useful to them and their purposes.
Common libraries is a great use of a Wiki- I'll make a new page.
  • Sequencing analysis:
I think that is the only thing not perfectly readily done with APE. By sequence analisis, I mean sequencing different samples of plasmid or PCR, looking at the electorphoregrams and aligning the text sequences to find out if there are some mutations. As an example, sequencing 5 lines of worms for the dat-1 gene and looking for a point mutation. What I do now is first checking the electrophorgrams to see if they are ok. Then I usually have features for the region I PCR amplified and sequences, so I try to annotate the text sequences. If the feature is short enough, that works and sequence analysis is done! But if the feature is longer than the sequence read, nothing is annotated and I need to check one sequence by one against the wild type to find out if the mutation is there, plus I need to go back to electrophoregrams to make sure the peaks are real...
So, would it be possible to implement or create a tool for this purpose? I was thinking that multiple alignment to the control sequence could be a first improvement. If that can be done with electrophoregrams that would be perfect. If not, a way might be to use the features: may be creating a reference sequence feature to annotate the wild type sequence, and instead of looking for the full sequence only, having the program "chopping" the sequence in bits of let's say 10 nucleotides (could be user defined), and annotating them. That would allow to see on one go if you sequenced what you expect and if there is a mutation, roughly where. If that could be done on the text sequence of the electrophoregrams (may be just adding features on the electrophoregrams would be already a huge improvement). Another intermediat step might be to be able to open and edit different sequences on the same window... If we would have 5 samples, the sequences would be on top of each other, normal annotation would be possible for each text sequence and adding "n" or "x" could be used to align manually the sequences...
Again, I don't know if this is clear enough or if there is more information needed, but please tell me.

Look at version 2.0.x from the latest alphas download page. It has an all new alignment algorithm with multiple alignments of sequences and/or abi files to a single reference.

  • Finally, I don't know it would be easier to have this page as a discussion page where different "themes" could be grouped together (primer feature, feature nomenclature, sequencing analysis,...) in order to avoid repeats in feature requests.
  • Thanks
I'll add new pages to the Wiki as needed to keep things clean and clear.


Hi,

One feature that I find missing is an improved Find tool that allows mismatches, or allow a specified number of mismatches between the actual sequence and the sequence you are looking for. This feature exists in pDRAW and is very useful. Mismatches could be highlighted in a specified color for example.
  • An interesting idea, I'll put it on my todo list



Also, in the Edit features window it's currently possible to raise or lower the order of the features but it could be good to have a "put at the bottom" / "put at the top" button, as it gets a bit long to push up or down the newly added feature when you already have a lot.

Thanks,
  • I'm working on a drag and drop function for faster rearranging of lists


It might be good to have a bit more tools for cloning:

- One tool to do in silico PCR: ask the sequence of the two primers and copy the amplified sequence and its annotations into a new file. As some primers for cloning can have a lot of additional bases not in the original sequence, it could be useful to be able to specify where are the bases of the sequence that are effectively annealing. With the same idea, it could be good to allow mismatches, and obviously to keep the sequence of the primers as the real sequence for the final result (if there are differences between the original sequence to be amplified and the primers).

- One tool to do in silico cloning, maybe to be put under the menu Tools, beside the recombination tool. This could ask the file or sequence of the target vector to clone into, ask the file/sequence of the fragment to be cloned in, the restriction enzymes used to cut both the fragment and vector (giving a choice to choose where to cut if there is more than one possible restriction site, and which fragment to keep for cloning if there are more than one “clonable” fragment/destination vector generated by the restriction digest). Copy the resulting sequence with the annotations into a new file. Could be a good thing to give at the same time the possibility to specify the new base #1 or keep the base numbering as it was in the targeted vector or in the fragment.

- Be able to do in silico digestion with a mix of two or more enzymes, maybe on the enzyme selection window one button “select as a mix” that would add some kind of “virtual enzyme” to the enzyme list with the ability to cut a the sites of all the selected enzymes.



New sequence algorithm suggestion
(I originally posted this in the discussion board for potential bugs, but upon reflection I figured this would be a better spot)

I've been using ApE for five years now and I love it. I'm using the newest alpha version 2_0_25_debug for OS X and I noticed that the alignment algorithm now automatically tries to rev-com your query sequences when attempting an alignment. While I like the feature, I was wondering if we could get a bit more control of it. Can you:

1) add an option to turn the automatic rev-com off and manually select the sequences to rev-com like in the two sequence align tool. Sometimes I don't want ApE to do the thinking for me.

2) add a text/color flag in the alignment window after an alignment that will tell you if a sequence has been automatically reverse complimented if the "auto rev-com option" is on? This would help the end user know what ApE did.

Thanks
  • I'm looking into how to make the best user interface for specifying the direction of the alignment.
  • I've added ">" and "<" characters after the leading and trailing index numbers on each line. Does that give enough info on direction?



A little bit of protein analysis/ ORF saving in a window allowing editing/ alignment will be wonderful.
  • You can save the results of translations as text files. You can make ORF maps. I don't know what you mean by editing. Protein analysis and alignment is a different function, which requires a different program. I have a prototype for a program like this that I might release someday.


ApE Feature Requests
1. When using a Feature Llibrary to annotate, allow features to "wrap" from end of sequence around to beginning. We are using your feature annotation to verify that our hanging primer designs are overlapping segments properly and this has a problem for the segments at the beginning and end of the plasmid (around the origin). If the annotation feature considered the DNA as one continuous loop and annotated right through the origin, that would be great.
  • That is odd- annotation of features using the library should wrap. Are you sure your sequence is circular? Look at the button in the upper right corner of the window. It should say "linear" or "circular", if "linear" click the button to make it circular.
  • You are correct, it was in linear mode and would not match on the "seam". Switching to circular and reannotating did the job. Thanks.

2. It would be nice to have an option in your Align DNA function to force it to keep one DNA strand contiguous, i.e., to not let it insert gaps, deletions, etc. in the strand. This is a bit like using the strand to annotate as a feature, but it does allow mismatches.
  • How would it know where to start the alignment? I don't see how this would work.
Here's an example. I have a sequence for a recombination site that is in my plasmid somewhere. The sequence is 25bp. I know the site is in the plasmid somewhere, but the plasmid may have one or more altered bases. The site should match somewhere in the plasmid, with some mismatches, but no gaps. I wrote an algorithm to do this in Excel. It essentially runs through every offset in the plasmid from the beginning to the end, and finds out how many bp match without allowing any gaps on either side at all. The best match has the lowest mismatches. When plotted, the site sequence has no gaps in it, only mismatches if any. I hope this makes more sense.
  • See the above request for a find that allows mismatches but no gaps. Do you need an alignment, or do you just need to find a sequence with mismatches?
  • I envisioned using the alignment tool. Perhaps adding an option that you can check to "not allow gaps". This has the effect of assigning an ifinite penalty to gaps (i.e., don't use them, just match as best you can with mismatching as needed.)


Not sure this is a feature, but is there or could there be a way to run ApE within a web browser? I'd like to have a sequence manager like ApE in a window directly within my Filemaker Pro database and FM can handle web stuff easily eg pdfs or web pages.
  • No- ApE is not written in a language that is easy to port into a web browser. I've seen people store sequences in a filmaker database as pure genbank text (using ApE's copy all as genbank function). Pasting this into a text field in FM keeps it stored with the plasmid record. Then to view it, you can just copy the gb text and paste it directly into an ApE window and it will open as a formatted file (this only works on more recent versions of ApE). I'm planning to have it write pdf files at some point.



Don't know if people are adding to the top or bottom of this... but anyway, first off wonderful program!! Very useful, great job and many kudos. Feature requests:

  1. There is a difference between the features present in the sequence being viewed, and the features in the library, it would be very nice if these features could be copied to the library (features you find in a downloaded sequence for instance).
  • I'm working on an update to the features functions- that will be in there. Updates are going slowly these days though
  1. Have a "Notes" section in the feature editing window. Just a simple text box where you could put some additional information or a link. Also, double clicking the feature would be an easy way to access that information. This would be an issue for overlapping features (it looks like you're working on overlapping features already from this wiki, so I need not mention it), but you could simply have a 'select a feature' feature, perhaps by holding ctrl and clicking the feature, and each click would highlight the next feature (going left to right in the order they're displayed above). Once the desired feature is selected, the name above the sequence window could be hyperlinked to the editing box.
  • You can right click on any part of the text and the popup menu gives you the option of editing any of the features currently under the mouse.
    • Thanks, I didn't see that before, but there's still no extra space to put notes or links about the feature. It would be nice to access more than just the title and sequence at your fingertips.
  1. Common libraries. I saw something on this above, and you mentioned making a page on the wiki, but I don't see it. This is the most important thing for me, I have a team I'd like to share all the features with. Even if you don't host the library on the wiki, is there a way to do this? Perhaps have the program save the libraries to a URL? Also, in addition to this, it would be very useful to be able to export libraries, so they can be sent to others. If there's a way to do this currently, please let me know.
  • URL for libraries is interesting. They are simply text, so you could download them and use them locally. Giving the program rights to upload can be difficult on some systems, so it might be easier to upload the text files separately as well, but I'll look into it.

Thanks :)

Update: I figured out the libraries are just the text files, which can easily be transferred. But if the program could open/save features to URLs, that would be much more convenient and offer real-time sharing. Also, an easy way to show multiple features on the DNA would be to underline the sequence instead of highlighting it. That way, you can simply have multiple underlines. Disadvantages to that system would be that you would require space to be added in between lines as needed (seems like a minor drawback), and the color would be less visible. However, you could also add patterns or directional arrows or something of the sort to the lines to accommodate for this.
  • I'm working on making the features semi-transparent when you mouse over or press a button on the sequence window. That makes it clear what features are overlapping. It would be almost impossible to have multiple layers of underlining, as well as very hard to read. You can, however, set the restriction highlighting to underline or bold if you want to distinguish thos highlights from feature highlight


Feature request (January 21, 2011)
ApE is a fantastic program, thank you for making it and improving it even more. There is a feature (that exists in DNA Strider) that I think would be worthy of inclusion in a future version of ApE: dot plots. Dot plots are interesting for both protein and DNA sequences as they are a visual and very powerful method to find repeated sequences (self dot plot) or similarities (dot plot between two sequences). Dot plots work by taking windows of N characters, in sequence A and B (or A for self-plots), calculating a similarity score and then graphing the score, if above a customizable threshold, as a function of the position of the middle character in the window on X and Y axes of a scatter plot. The method is computationally intensive since every window has to be compared with all the windows of N characters of the other sequence. However, the results of a dot plot are easy to interpret and dot plots are very sensitive ways to identify regions of low similarity that have a different order in two related sequences.
Thank you.



Feature request (March 4, 2011)

Thank you so much for a wonderful program. Just a couple things I miss from other programs:
1) The ability to change font italics/bold/color for better annotation in the text window.
2) More options in the graphic map view. When you have a lot of features, the thick arrows get a little bulky. Maybe instead, we should have the options of lines or just markers (like how enzymes are marked)

I don't know how feasible these are, but I thought I'd ask.
  • I'm working slowly on a rewrite of the graphic map that will do what you describe and a few other things.
  • You can change the italics/bold of enzyme highlighting. It'll probably be possible with features at a future point- I'm planning to rewrite the feature handling so that it handles much more information and formatting in the feature descriptions, as well as a n all new feature scanning algorithm that should be faster and allow for a maximum mismatch within a part of the feature.


Feature request (March 18, 2011)
ApE is fantastic! I second the idea of in-silico PCR, say ApE can show potential PCR products size with some thermodynamic parameters (i.e. Tm) of not-perfectly-annealing primers. For examples, here is a in silico PCR report from VectorNTI which is very useful for designing cloning primers:

#1: Product of length 376 (rating: 153)
Contains region of the molecule from 1 to 336
Tm: 79.3 C TaOpt: 61.2 C GC: 51.6
Sense Primer:
AGACATGCATATG GGGGAGGACTTCAGCAAG
Similarity of primer without 5' attachment: 100.0%
Length: 31 Tm: 68.7 C GC: 51.6
dH: -236.4 kcal/mol dS: -603.8 cal/mol dG: -54.6 kcal/mol
Antisense Primer:
GGCAACTAGTGCATCTCCCGTGATGCA CTGGTGCTTTGGTTTCTCAGGTGGTAATC
Similarity of primer without 5' attachment: 100.0%
Length: 56 Tm: 69.1 C GC: 51.8
dH: -429.7 kcal/mol dS: -1088.0 cal/mol dG: -103.5 kcal/mol
Tm Difference: 0.4
GC Difference: 0.2

By the way, is it possible to show translated amino acid sequences with assembled/aligned ABI sequences?



Feature Request (June 29, 2011)

ApE is great. I'd really appreciate continued Linux support. Pretty please.



Feature Request (September 7, 2011)

I recently installed Lion and am really enjoying the Auto Save feature that were added. I'd love it if I never had to worry about saving changes in ApE again and could look back through the past versions of a plasmid file. Any chance of these features being added?
  • Version support in Lion is interesting. I'll have to see how it all gets supported by the Tcl/Tk team.





Feature Request (September 20, 2012)

Is is possible to have APE compatible with retina display?
  • Probably. What is the issue with ApE on the retina display?

The fonts are very fuzzy on retina display. So are all the icons.



Feature Request (October 3, 2012)

I love ApE. It works far better than all of the other programs that I have used and the graphics are the best by far. The one feature that would make it the premiere cloning tool would be to have virtual ligations (2 way, and 3 way). Being able to virtually cut a fragment, see the sticky ends, and then be able to ligate it with another fragment to form a product would be tremendous. Otherwise, I am indebted to you for the work you have put into this, making my cloning a snap. Thanks.
Other than explicitly seeing the ends, you can do that right now.
If you do a restriction digest then click on the band on the gel, the region from cut site to cut site is selected. Do this for the backbone vector, selecting the region that you are replacing. If you then do the same for the insert fragment, selecting the new insert fragment, then do command-c on the insert (copy), then command-v on the backbone (paste), you have done a virtual cut and paste where the ends are correct. Of course, you can also cut and paste where the ends aren't compatible this way, ApE won't stand in your way.





Feature Request (December 25, 2012)

I really, really like ApE, but one thing that I really need is a good way to handle overlapping annotations. The way Text Map handles overlapping annotations is fine, but it has some serious limitations, such as not being able to edit (delete or paste a sequence) into the Text Map window. In addition, you can click on a sequence in the Text Map window to jump to the corresponding sequence in the main sequence window, but not vice versa--you cannot jump to a specific location in the Text Map window from the sequence window. The Text Map also does not update in real time, so you have to constantly re-make them, and this is ridiculously cumbersome because the window size and position resets every time!!

I think there needs to be a better way of displaying annotations within the main sequence view--a simple background is not enough, as overlapping features are common. One solution to this would be to have a few-pixels-high line for each annotation directly below its corresponding sequence (I've mocked up an example here). If you want to use less vertical real estate, you could even get rid of the labels and have only color. If you click on a colored line, it should select the entire sequence corresponding to that particular annotation.

Two more small but benefit-dense features would be remembering of window position and size, and multiple-level undo.

Thanks so much, and keep up the great work!! :)



Feature Requests (February 27, 2013): trace editing, consensus/translations in alignment, Short-cut "Save As", type IIS restriction enzymes, ds restriction sites

  1. It would be nice to be able editing/modifying the text sequence in an ab1/scf sequence trace/chromatogram.
  2. Would it be possible to implement an option to switch on/off consensus sequence and translation for the alignment tool?
  3. Could you implement a short cut for "Save As" like Ctrl+Shift+S (Linux/Win) or Cmd+Shift+S (OSX)
  4. It was asked before: Is it possible to add also restriction sites for the type IIS enzymes?
  5. It would be useful to have somewhere an option to view restriction cleavage sites on both strands (double-stranded view).
Thanks
1. double click on an abi base should edit it.
2. The alignment HAS to align to a consensus. There is no multiple alignment or contig generation. The translation only happens with CDS features, so if you take out the features or make them any other type there will be no translation.
3. Save as shortcut will be easy to implement.
4. You can add type IIS enzymes in the enzyme selector dialog. Just go to the menus and select "Enzymes>New Enzyme...". All of the commercial enzymes are available in the enzyme set "Rebase_available_Enzymes". Just go to File>Open New Enzyme Set". You can delete any that you don't want, then save that set as you default if you prefer. You can also import a large set of enzymes in Strider format with "File>Import ".
5. If you highlight the enzymes in the sequence, then put your mouse over the enzyme sequence, it shows the cut site as a text annotation showing how the enzyme cuts (You need to be familiar with reading them to see both strands).




Feature Request (March 11, 2013): automatic recognition of features based on capitalization

When I download sequence files, the exons are capitalized. I usually go through manually and create a feature for each exon. I guess my request is for a way to select a region of text and automatically create features from all the capitalized regions (or all the non-capitalized regions). If I could select the color and maybe label them numerically, all the better.

Thanks for all the hard work.
If you put the whole thing in, you'll get a feature with the whole cds, with the introns not part of the feature. With this, you can get translations of the cds in the translation window, as well as in alignments. I'm not sure I see the advantage in each exon being a separate feature. I'm planning to write a way to take found highlighting and make a set of features. So you could take your text, pase it into a feature library definition, use the convert lowercase to plus, copy that into a text editor, convert plus to spaces, paste that into the find window, do highlight all, then convert highlighting to features.



Feature Request (March 27, 2013): Continuous Alignment of Sequences against circular DNA

Is it possible to align DNA sequences (e.g. from sequencing) against circular DNA continuously? I mean to continue after the last base of the template (with the beginning of the template) or reversely, to continue backwards before the start of the template (with its end).
Recently, I checked the sequence of a circular plasmid and the reverse primer gave me the first 800 bases as well as the last 200 bases at the end of the template. When I aligned everything in ApE it showed a proper alignment for the first 800 bases but it did not align anything backwards matching the sequence at the end of the template.

It isn't possible at this time, but that's something I'd like to do sometime soon.



Feature Request (or help with current feature?)

I have modified a standard vector that I imported from a genbank file. Now I'd like to save that in genbank format, but need to edit the "locus" information in order to use it with J5 (j5.jbei.org) but I can't see how to do that. For now I'm using pico on the text file, but it would be great to have these fields file open in a text editor within APE, or to have these fields displayed somewhere, where it can be edited

Feature Request (March 26, 2013): Removal of the "Would you like to quit promot"

Is is possible to make this feature optional? There are times when I need to close all windows rather than quit the program. It may sound silly, however the prompt disrupts my workflow.

-I second this. Please, either go back to the old way or have it quit automatically upon closing the last window. The dialog prompted me to revert back to v. 2.0.45.

Feature Request (October 16, 2014): DNA sequence text coloring and annotation
A feature I cannot find in many plasmid analysis computer applications and would be VERY useful, is the ability to color
segments of the DNA sequence with a variety of (text) colors. This is different than coloring features. When one examines a plasmid sequence in order to add peptide tags, splice together DNA fragments correctly, adds/removes pieces of DNA via mutagenesis, etc, the ability to color and to tag portions of the DNA sequence in bold, underscore, strikethrough, larger/smaller letters, with shadows, maybe arrows underneath, etc, is very useful. Again, this is different than the "features" tool. Of course, using the features tool to mark recurrent DNA segments (promoters, rec sites, terminators, etc) is important, of course. However , often one needs only to color or highlight certain parts of a sequence without making "features". I do a lot of cloning and such flexibility would be VERY useful when one works with overlapping DNA fragments, primers, restriction sites, etc.
Would it be possible to introduce such a DNA sequence “coloring, editing” property in the application?

I don't get why it HAS to be a parallel process from adding a feature. The features can be removed easily, making temporary highlighting quite possible. I get that you are asking for orthogonal (visually independent) way to set off regions of DNA that overlap with each other. You might try the x-ray window function. Press the spacebar in a window that has overlapping features on it. Then put your mouse in the same line as the overlapping feature (just point, don't click). You'll see a floating window with a graphic map of all of the features on the line you are pointing to. See if that gives you a way to see what you need easily.

Thank you for your reply. I will try the x-ray window. The main reason from keeping text and feature coloring separately is to assign each their proper importance. A feature is something to keep, to use recurrently, something that may be found from time to time in other sequences. Coloring text is very useful when you want to highlight a nucleotide, or a few of them, mark a region that one needs to be aware of when designing primers, mutagenesis, etc. Coloring the text may apply to only that opened file, but is visually very useful in identifying certain patterns or sequences to be mindful of. It is inconvenient to make "features" of all short, maybe unique sequences one NEVER needs again, or never encounters again, they just clutter the feature collection with unimportant entities. To give you an example, please see figure attached (example1.jpg).example1.jpg This is a portion of a Gateway plasmid, processed in GeneConstructionKit (I would very much like NOT to have to use GCK any longer, but the coloring and text processing, I find very useful, even though the version I am using does not have good "features" capability). Highlighting, annotating and coloring text in different ways makes it possible to quickly identify elements that are important for the work. Combining the use of "features" like ApE has, with being able to highlight/color/underline/etc the DNA sequence "on the fly" would be very, very useful. Thank you, again.

I see your issue- you are only adding features by adding them to the feature collection and scanning. If you just want to temporarily visually offset a region, you should just select it and do "Features>Add Feature" from the main menu. When you are done, you can right click on the region and delete the feature. It never clutters your feature collection that way. The four or five different text formats and text spacings going on here look hard for one's brain to keep track of. Let me know what you think after trying temporary features and the X-ray window.



Feature Request (8th December 2014): GC plot
Could you add a feature (e.g. under the tools menu) to plot the GC content calculated within a user defined window (e.g 20 bases) that moves along a selected or full sequence? That would be useful for identifying difficult areas for PCR amplification.

Thank you very much.