Use this page to share any feature libraries that you think others might find useful.
Add them as plain text, or add them as a discussion thread, or put a link to a complete file.


F2A GTGAAACAGACTTTGAATTTTGACCTTCTCAAGTTGGCAGGAGACGTTGAGTCCAACCCTGGGCCC misc_feature #804040 #804040 0 0
P2A gccacgaacttctctctgttaaagcaagcaggagatgttgaagaaaaccccgggcct misc_feature #804040 #804040 0 0
T2A gagggcaggggaagtcttctaacatgcggggacgtggaggaaaatcccggcccc misc_feature #804040 #804040 0 0
F2A GTGAAACAGACTTTGAATTTTGACCTTCTCAAGTTGGCAGGAGACGTTGAGTCCAACCCTGGGCCA misc_feature #804040 #804040 0 0
E2A caatgtactaattacgcactgctgaaactcgctggggacgtagagtccaatccaggaccc misc_feature #804040 #804040 0 0

Annotate your files with the free primers from MC Labs by right-clicking to save as into your ApE Features file (current as of October 5, 2010):
MCLab free oligos 05Oct2010.txt

Here is the list of the oligos available at the GATC sequencing company. They will appear in green if sens and light green if reverse complement (if anyone knows how to make a link to a file, I can provide the original file):

1492r TACGGYTACCTTGTTACGACTT GATColigo #80ff00 #ccff66 0

16S-1392r ACGGGCGGTGTGTGTRC GATColigo #80ff00 #ccff66 0

16S-27f AGAGTTTGATCMTGGCTCAG GATColigo #80ff00 #ccff66 0

35S-A AAGGGTCTTGCGAAGGATAG GATColigo #80ff00 #ccff66 0

35S-B AGTGGAAAAGGAAGGTGGCT GATColigo #80ff00 #ccff66 0

3'-Gal 4 GAACTTGCGGGGTTTTTC GATColigo #80ff00 #ccff66 0

BAC1 GCTCGTATGTTGTGTGGAATTG GATColigo #80ff00 #ccff66 0

BAC2 CCCAGTCACGACGTTGTAAAAC GATColigo #80ff00 #ccff66 0

BGH-Reverse TAGAAGGCACAGTCGAGG GATColigo #80ff00 #ccff66 0

CMV-F CGCAAATGGGCGGTAGGCGTG GATColigo #80ff00 #ccff66 0

EBV-RP GTGGTTTGTCCAAACTCATC GATColigo #80ff00 #ccff66 0

EGF1 CCAAGCTATTTAGGTGACAC GATColigo #80ff00 #ccff66 0

EGF2 GGGGATGTGCTGCAAGG GATColigo #80ff00 #ccff66 0

GFPN1-5 GAGCTCAAGCTTCGAATTC GATColigo #80ff00 #ccff66 0

GLprimer1 TGTATCTTATGGTACTGTAACTG GATColigo #80ff00 #ccff66 0

KAN2-FP ACCTACAACAAAGCTCTCATCAACC GATColigo #80ff00 #ccff66 0

KAN2-RP GCAATGTAACATCAGAGATTTTGAG GATColigo #80ff00 #ccff66 0

KS TCGAGGTCGACGGTATC GATColigo #80ff00 #ccff66 0

LPP1 ATACGACTCACTATAGGGAGAC GATColigo #80ff00 #ccff66 0

LPP2 ACAAATTGGACTAATCGATGGC GATColigo #80ff00 #ccff66 0

M13-FP TGTAAAACGACGGCCAGT GATColigo #80ff00 #ccff66 0

M13-RP CAGGAAACAGCTATGACC GATColigo #80ff00 #ccff66 0

pACT2-FP GATGATGAAGATACCCCAC GATColigo #80ff00 #ccff66 0

pACT2-RP CAGTTGAAGTGAACTTGC GATColigo #80ff00 #ccff66 0

pBacPAC-RP GTCTGTAAATCAACAACGC GATColigo #80ff00 #ccff66 0

pBAD-FP ATGCCATAGCATTTTTATCC GATColigo #80ff00 #ccff66 0

pBakPAC-FP TAAAATGATAACCATCTCGC GATColigo #80ff00 #ccff66 0

pBR1 CGAAAAGTGCCACCTGAC GATColigo #80ff00 #ccff66 0

pBR2 GGAGCCACTATCGACTAC GATColigo #80ff00 #ccff66 0

pBR3 TCCCCATCGGTGATGTC GATColigo #80ff00 #ccff66 0

PBR4 CTCGGCACCGTCACC GATColigo #80ff00 #ccff66 0

pc3.1GFP-Topo-RP CCCATTAACATCACC GATColigo #80ff00 #ccff66 0

pcDNA1.1-RP CTCTGTAGGTAGTTTGTCC GATColigo #80ff00 #ccff66 0

pcDNA1.1-RP/1 TAGAATCAGTAGTTTAACAC GATColigo #80ff00 #ccff66 0

pcDNA3.1-FP CTCTGGCTAACTAGAGAAC GATColigo #80ff00 #ccff66 0

pcDNA3.1-RP/1 CAAACAACAGATGGCTGGC GATColigo #80ff00 #ccff66 0

PCR1 CGGGCCTCTTCGCTATT GATColigo #80ff00 #ccff66 0

PCR1minus1 GGGCCTCTTCGCTATT GATColigo #80ff00 #ccff66 0

PCR2 TTAGCTCACTCATTAGG GATColigo #80ff00 #ccff66 0

pDONOR-FP TAACGCTAGCATGGATCTC GATColigo #80ff00 #ccff66 0

pDONOR-RP GCAATGTAACATCAGAGAT GATColigo #80ff00 #ccff66 0

pEGFP_C2-FP GATCACATGGTCCTGCTG GATColigo #80ff00 #ccff66 0

pEGFP_C2-RP TTTAAAGCAAGTAAAACCTC GATColigo #80ff00 #ccff66 0

pEGFP_N CCGTCCAGCTCGACCAG GATColigo #80ff00 #ccff66 0

pEGFP-FP TTTAGTGAACCGTCAGATC GATColigo #80ff00 #ccff66 0

pEGFP-RP AACAGCTCCTCGCCCTTG GATColigo #80ff00 #ccff66 0

pESP-RP TCCAAAAGAAGTCGAGTGG GATColigo #80ff00 #ccff66 0

pET-24a GGGTTATGCTAGTTATTGCTCAG GATColigo #80ff00 #ccff66 0

pET30er-FP TCATCATTCTTCTGGTCTG GATColigo #80ff00 #ccff66 0

pET36b-FP GCTAAATTCGAACGCCAG GATColigo #80ff00 #ccff66 0

pETBlue-RP AATAGCTTTAATGCGGTAG GATColigo #80ff00 #ccff66 0

pET-RP CTAGTTATTGCTCAGCGG GATColigo #80ff00 #ccff66 0

pGBT9-FP AGTGCGACATCATCATCG GATColigo #80ff00 #ccff66 0

pGBT9-RP CGTTTTAAAACCTAAGAGTCAC GATColigo #80ff00 #ccff66 0

pGEX-3 GGAGCTGCATGTGTCAGAG GATColigo #80ff00 #ccff66 0

pGEX3-RP TCAAGAATTATACACTCCG GATColigo #80ff00 #ccff66 0

pGEX-5 CTGGCAAGCCACGTTTGG GATColigo #80ff00 #ccff66 0

pGEX5-FP AACGTATTGAAGCTATCCC GATColigo #80ff00 #ccff66 0

pGFP-FP GAGTTTGTAACAGCTGCTG GATColigo #80ff00 #ccff66 0

pGL2 TCTTTATGTTTTTGGCGTC GATColigo #80ff00 #ccff66 0

pGL3-1 GAGCTGACTGGGTTGAAG GATColigo #80ff00 #ccff66 0

pGL3-RV3 CTAGCAAAATAGGCTGTCC GATColigo #80ff00 #ccff66 0

pIRES-RP TATAGACAAACGCACACCG GATColigo #80ff00 #ccff66 0

pJet1-FP ACTACTCGATGAGTTTTCGG GATColigo #80ff00 #ccff66 0

pJet1-RP TGAGGTGGTTAGCATAGTTC GATColigo #80ff00 #ccff66 0

pMalE TCAGACTGTCGATGAAGC GATColigo #80ff00 #ccff66 0

pMT-FP CATCTCAGTGCAACTAAAG GATColigo #80ff00 #ccff66 0

PolyA-B AAAAAAAAAAAAAAAAAAAAAAAB GATColigo #80ff00 #ccff66 0

PolyC-D CCCCCCCCCCCCD GATColigo #80ff00 #ccff66 0

PolyT-V TTTTTTTTTTTTTTTTTTTTTV GATColigo #80ff00 #ccff66 0

pQE-FP CGGATAACAATTTCACACAG GATColigo #80ff00 #ccff66 0

pQE-RP GTTCTGAGGTCATTACTGG GATColigo #80ff00 #ccff66 0

pQE-RP-50 CTAGCTTGGATTCTCACC GATColigo #80ff00 #ccff66 0

pREP-FP GCTCGATACAATAAACGCC GATColigo #80ff00 #ccff66 0

pRH-FP CTGTCTCTATACTCCCCTATAG GATColigo #80ff00 #ccff66 0

pRH-RP CAAAATTCAATAGTTACTATCGC GATColigo #80ff00 #ccff66 0

pRSET-RP ATGCTAGTTATTGCTCAGC GATColigo #80ff00 #ccff66 0

pRSET-RPnew GGGTTATGCTAGTTATTGC GATColigo #80ff00 #ccff66 0

pTal-FP CGGGAGGTACTTGGAGCG GATColigo #80ff00 #ccff66 0

pTeSp-1 CCTCCATAGAAGACACC GATColigo #80ff00 #ccff66 0

pTeSp-2 GCCCTGCCACTCATCG GATColigo #80ff00 #ccff66 0

pTI2-1-1 GGCAAATATTCTGAAATGAGC GATColigo #80ff00 #ccff66 0

pTI2-1-2 GCGTTTCACTTCTGAGTTCG GATColigo #80ff00 #ccff66 0

pTrcHis-FP GACCGGAATTATCGATTAAC GATColigo #80ff00 #ccff66 0

pTrcHis-RP CTGATTTAATCTGTATCAGG GATColigo #80ff00 #ccff66 0

pTYB-FP GGAAGACGATTATTATGGG GATColigo #80ff00 #ccff66 0

pUC-F GCCAGTGAATTCGAGCTCGG GATColigo #80ff00 #ccff66 0

pUC-R TGCCTGCAGGTCGACTCTAG GATColigo #80ff00 #ccff66 0

pVL1 GGGTTTAACATTACGGATTTC GATColigo #80ff00 #ccff66 0

pVL2 GACGCACAAACTAATATCAC GATColigo #80ff00 #ccff66 0

pVP22-FP CGCTTCTCGCCCCAGAC GATColigo #80ff00 #ccff66 0

RPC ACAGCTATGACCATGATTACG GATColigo #80ff00 #ccff66 0

SK CGCTCTAGAACTAGTGGATC GATColigo #80ff00 #ccff66 0

SP6 ATTTAGGTGACACTATAGAA GATColigo #80ff00 #ccff66 0

T3 ATTAACCCTCACTAAAGGGA GATColigo #80ff00 #ccff66 0

T7 TAATACGACTCACTATAGGG GATColigo #80ff00 #ccff66 0

T7-981079 TAATACGACTCACTATAG GATColigo #80ff00 #ccff66 0

T7minus1 AATACGACTCACTATAGGG GATColigo #80ff00 #ccff66 0

TET-1 FP-1 GGGTGCGCATGATCCTCTAGAGT GATColigo #80ff00 #ccff66 0

TET-1 RP-1 TAAATTGCACTGAAATCTAGAAATA GATColigo #80ff00 #ccff66 0

Topo-1 TCGGATCCACTAGTAACG GATColigo #80ff00 #ccff66 0

Topo-2 GTGTGATGGATATCTGC GATColigo #80ff00 #ccff66 0

Topo-2N AGATGCATGCTCGAGCGG GATColigo #80ff00 #ccff66 0

TriplEx5`LD GAAGCGCGCCATTGTGTTGG GATColigo #80ff00 #ccff66 0

UP-2 CGTTGTAAAACGACGGCC GATColigo #80ff00 #ccff66 0

UP-40 GTTTTCCCAGTCACGAC GATColigo #80ff00 #ccff66 0


Here is the list of the oligos available at the MWG sequencing company. They will appear in blue if sens and light blue if reverse complement (if anyone knows how to make a link to a file, I can provide the original file):

-96gIII CCCTCATAGTTAGCGTAACG MWGoligo #03aeff #b8f0ff 0 0

3AOX GCAAATGGCATTCTGACATCC MWGoligo #03aeff #b8f0ff 0 0

5AOX GACTGGTTCCAATTGACAAGC MWGoligo #03aeff #b8f0ff 0 0

alpha-f TACTATTGCCAGCATTGCTGC MWGoligo #03aeff #b8f0ff 0 0

CMVfor CGCAAATGGGCGGTAGGCGTG MWGoligo #03aeff #b8f0ff 0 0

CMVmin CGCCATCCACGCTGTTTTG MWGoligo #03aeff #b8f0ff 0 0

CMV_HC_for CTCTAGCGCCACCATGAAACA MWGoligo #03aeff #b8f0ff 0 0

EuVH GGCAGCAGCCACAGGTAAGA MWGoligo #03aeff #b8f0ff 0 0

EuVL TTGCTGTTGCACAGTGATTC MWGoligo #03aeff #b8f0ff 0 0

Gad for GGGATGTTTAATACCACTAC MWGoligo #03aeff #b8f0ff 0 0

Gad rev AAGAAATTGAGATGGTGCAC MWGoligo #03aeff #b8f0ff 0 0

Gal4 AD TACCACTACAATGGATG MWGoligo #03aeff #b8f0ff 0 0

Gal4 BD TCATCGGAAGAGAGTAG MWGoligo #03aeff #b8f0ff 0 0

HuCAL_rev TTTTTCACTTCACAGGTC MWGoligo #03aeff #b8f0ff 0 0

HuCAL_VH_for GATAAGCATGCGTAGGAGAAA MWGoligo #03aeff #b8f0ff 0 0

HuCAL_VL_for_30 GAGTCTTAAGTAATCTAGATAACG MWGoligo #03aeff #b8f0ff 0 0

IgG_const_for AGCCCAGCAACACCAAGG MWGoligo #03aeff #b8f0ff 0 0

IntXL39 ATTAGGACAAGGCTGGTGG MWGoligo #03aeff #b8f0ff 0 0

M13 (-96) TGAGTTTCGTCACCAGTA MWGoligo #03aeff #b8f0ff 0 0

M13 rev (-29) CAGGAAACAGCTATGACC MWGoligo #03aeff #b8f0ff 0 0

M13 rev (-49) GAGCGGATAACAATTTCACACAGG MWGoligo #03aeff #b8f0ff 0 0

M13 uni (-21) TGTAAAACGACGGCCAGT MWGoligo #03aeff #b8f0ff 0 0

M13 uni (-43) AGGGTTTTCCCAGTCACGACGTT MWGoligo #03aeff #b8f0ff 0 0

malE GGTCGTCAGACTGTCGATGAAGCC MWGoligo #03aeff #b8f0ff 0 0

MSCV-MCS-5 CGTTCGACCCCGCCTCGATCC MWGoligo #03aeff #b8f0ff 0 0

pcDNA3_for GGCTAACTAGAGAACCCACTG MWGoligo #03aeff #b8f0ff 0 0

pcDNA3_rev GGCAACTAGAAGGCACAGTC MWGoligo #03aeff #b8f0ff 0 0

pCEP-Forward AGAGCTCGTTTAGTGAACCG MWGoligo #03aeff #b8f0ff 0 0

pCEP-Reverse GTGGTTTGTCCAAACTCATC MWGoligo #03aeff #b8f0ff 0 0

pCR3.1-BGHrev TAGAAGGCACAGTCGAGG MWGoligo #03aeff #b8f0ff 0 0

pEGFPC1for GATCACTCTCGGCATGGAC MWGoligo #03aeff #b8f0ff 0 0

pEGFPC1rev CATTTTATGTTTCAGGTTCAGGG MWGoligo #03aeff #b8f0ff 0 0

pEGFPN1for GTCGTAACAACTCCGCCC MWGoligo #03aeff #b8f0ff 0 0

pEGFPN1rev GTCCAGCTCGACCAGGATG MWGoligo #03aeff #b8f0ff 0 0

pEGFP_35rev AGGTTAAGTAAAGCGTCTG MWGoligo #03aeff #b8f0ff 0 0

pEGFP_35uni ACCGTAAGTAGCATCACCTTC MWGoligo #03aeff #b8f0ff 0 0

pEGFP_36rev TGGTCTTGTTAGAATTTGTTAC MWGoligo #03aeff #b8f0ff 0 0

pEGFP_36uni CTTTTCGGTTAGAGCGGATGTG MWGoligo #03aeff #b8f0ff 0 0

pENTattL1for TCGCGTTAACGCTAGCATGGATCTC MWGoligo #03aeff #b8f0ff 0 0

pENTattL2rev ACATCAGAGATTTTGAGACACGGGC MWGoligo #03aeff #b8f0ff 0 0

pESC_MCS1r GGATATGTATATGGTGGTAATGC MWGoligo #03aeff #b8f0ff 0 0

pESC_MCS1u TGACCAAACCTCTGGCGAAG MWGoligo #03aeff #b8f0ff 0 0

petup ATGCGTCCGGCGTAGA MWGoligo #03aeff #b8f0ff 0 0

pEX-For GGAGCAGACAAGCCCGTCAGG MWGoligo #03aeff #b8f0ff 0 0

pEX-Rev CAGGCTTTACACTTTATGCTTCCGGC MWGoligo #03aeff #b8f0ff 0 0

pFASTBAC-F TCCGGATTATTCATACCGTCCC MWGoligo #03aeff #b8f0ff 0 0

pFASTBAC-R CCTCTACAAATGTGGTATGGCTG MWGoligo #03aeff #b8f0ff 0 0

pGex for ATAGCATGGCCTTTGCAGG MWGoligo #03aeff #b8f0ff 0 0

pGex rev GAGCTGCATGTGTCAGAGG MWGoligo #03aeff #b8f0ff 0 0

pGL for GTATCTTATGGTACTGTAACTG MWGoligo #03aeff #b8f0ff 0 0

pGL rev CTTTATGTTTTTGGCGTCTTCC MWGoligo #03aeff #b8f0ff 0 0

pGL3 for CTAGCAAAATAGGCTGTCCC MWGoligo #03aeff #b8f0ff 0 0

pJET1.2for CGACTCACTATAGGGAGAGCGGC MWGoligo #03aeff #b8f0ff 0 0

pJET1.2rev AAGAACATCGATTTTCCATGGCAG MWGoligo #03aeff #b8f0ff 0 0

pJET1_fwd GCCTGAACACCATATCCATCC MWGoligo #03aeff #b8f0ff 0 0

pJET1_rev GCAGCTGAGAATATTGTAGGAGATC MWGoligo #03aeff #b8f0ff 0 0

Polyhed_fwd AAAATGATAACCATCTCG MWGoligo #03aeff #b8f0ff 0 0

Polyhed_rev CGGGTCCAAGTTTCCCTG MWGoligo #03aeff #b8f0ff 0 0

pQE for GTATCACGAGGCCCTTTCGTCT MWGoligo #03aeff #b8f0ff 0 0

pQE rev CATTACTGGATCTATCAACAGGAG MWGoligo #03aeff #b8f0ff 0 0

pShuttleCMV-f GGTCTATATAAGCAGAGCTG MWGoligo #03aeff #b8f0ff 0 0

pShuttleCMV-r GTGGTATGGCTGATTATGATCAG MWGoligo #03aeff #b8f0ff 0 0

pTrcHis for AATCTGTGTGGGCACTCG MWGoligo #03aeff #b8f0ff 0 0

pTrcHis rev CTTCTGCGTTCTGATTTAATCTG MWGoligo #03aeff #b8f0ff 0 0

seqcible1 GCATTGGGTCAACAGTATAGAACCGTGGATGA MWGoligo #03aeff #b8f0ff 0 0

seqdup220 CCATTGCTGATTAGAGGAGTCAAC MWGoligo #03aeff #b8f0ff 0 0

seqgal10f2 CCTTATACATTAGGTCCTTTGTAGC MWGoligo #03aeff #b8f0ff 0 0

seqgal10r2 TTTCTGGCAAGGTAGACAAGC MWGoligo #03aeff #b8f0ff 0 0

SP 6 CATTTAGGTGACACTATAG MWGoligo #03aeff #b8f0ff 0 0

T3 AATTAACCCTCACTAAAGGG MWGoligo #03aeff #b8f0ff 0 0

T7 TAATACGACTCACTATAGGG MWGoligo #03aeff #b8f0ff 0 0

T7 (pCS-2) TGTCTGGATCTACGTAATACG MWGoligo #03aeff #b8f0ff 0 0

T7 term CTAGTTATTGCTCAGCGGT MWGoligo #03aeff #b8f0ff 0 0

v5epitoperev CGTAGAATCGAGACCGAGGAGAGG MWGoligo #03aeff #b8f0ff 0 0